Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circCRIM1 | |||
Gene | CRIM1 | Organism | Human |
Genome Locus | chr2:36623756-36669878:+ | Build | hg19 |
Disease | Lung Adenocarcinoma | ICD-10 | Lung Adenocarcinoma (C34) |
DBLink | Link to database | PMID | 31301086 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Tumor tissues and paired peripheral normal lung tissues from LUAC patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GTCCCCCGGACAGCTATGAA ReverseCAAAGGGATTGCTGCAGGTTC | Statistics | Fold Change : Downregulated pvalue : <0.05 |
Citation | |||
Wang, L, Liang, Y, Mao, Q, Xia, W, Chen, B, Shen, H, Xu, L, Jiang, F, Dong, G (2019). Circular RNA circCRIM1 inhibits invasion and metastasis in lung adenocarcinoma through the microRNA (miR)-182/miR-93-leukemia inhibitory factor receptor pathway. Cancer Sci., 110, 9:2960-2972. |